Znn3bq.jpeg
²é¿´: 1049  |  »Ø¸´: 0

bxzc123

½ð³æ (ÕýʽдÊÖ)

[ÇóÖú] Çó·­Ò룬лл£¬Õ¾ÄÚÐÅ

Materials and Methods
2.1. Isolation of Marine Actinomycetes
Marine invertebrate sample (Sample ID: NIO_SA_An_15) was collected from deep sea (Anjuna Beach, Goa,
India) in sterile polypropylene bag and stored at 4˚C. The invertebrate (~10 g) sample was washed thrice with
sterile demineralized water to remove the adhering particles like sand, sea weeds and then crushed in the sterile
mortar and pestle. The crushed sample was serially diluted to 10 −8 . Last three dilutions viz. 10 −6 , 10 −7 and 10 −8
were surface spreaded on the actinomycetes isolation agar (AIA) medium (Himedia, India) prepared in 75% (v/v)
artificial sea water (AS-AIA). The plates were incubated at 30˚C till 30 days and observed periodically for the
growth of actinomycetes colonies. The well isolated colonies were picked up, purified and grown on AS-AIA
slants (made in 75% ASW). The well grown isolates on the slants were preserved at 4˚C.
2.2. Primary Screening of Marine Actinomycetes for Antimicrobial Activity
The isolated marine actinomycetes were screened for their antimicrobial activity. The loopful of the growth
from the slant was inoculated into 50 ml of seed medium; ASW-274(1) [glucose 15 g/L, corn steep liquor 5 g/L,
sodium chloride 5 g/L, calcium carbonate 2 g/L, peptone 7.5 g/L, yeast extract 7.5 g/L, made in 75% ASW, pH
7.0 to 7.5] distributed in 250 ml Erlenmeyer flask and incubated for 96 h at 30˚C at 200 rpm on a rotary shaker.
A 3 ml of well grown pure seed was transferred to the 100 ml of each media in 500 ml Erlenmeyer flask. Three
different production media used were as followed: ASW-SM12(1) [glucose 50 g/L, yeast extract 11 g/L, pep-
tone 4 g/L beef extract 4 g/L, sodium chloride 2.5 g/L, calcium carbonate 5 g/L, made in 75% ASW, pH 7.4 -
7.6]; ASW-36P(1) [soluble starch 20 g/L, glucose 15 g/L, yeast extract 2 g/L, peptone 3 g/L, calcium carbonate
2 g/L, ammonium sulphate 0.5 g/L, corn steep liquor 2 g/L, sodium chloride 2 g/L, magnesium phosphate 5 g/L,
cobalt chloride 0.001 g/L and TSS 1 ml/L (copper sulphate 7 g, ferrous sulphate 1 g, manganese chloride 8 g,
zinc sulphate 2 g and demineralized water 1 L), made in 75% ASW pH 7.3 - 7.6]; ASW-1M [glycerol 30 g/L,
glucose 3 g/L, yeast extract 2 g/L, sodium chloride 3 g/L, sodium nitrate 1 g/L, calcium carbonate 3 g/L, pep-
tone 3 g/L and TSS 1 ml/L, made in 75% ASW, pH 7.0 - 7.2]. The flasks were incubated for 96 h at 30˚C on ro-
tary shaker at 200 rpm. The 1 ml of harvested whole broth was extracted with equal amount of methanol and
centrifuged at 4000 rpm for 10 min. The supernatant was tested for antimicrobial activity by agar well diffusion
method using different pathogenic strains [14]. LR grade chemicals were used in the study.
2.3. Secondary Screening of Active Isolate and Antifungal Activity
The isolate PM0525875 which exhibited exclusive antifungal activity was screened for its reproducibility as per
the procedure mentioned in 2.2. The methanolic extract of the whole culture broth, cell mass extract and cell free
culture filtrate were tested against Candida sp. to confirm the antifungal activity. To rule out the presence of
polyene in the active extract, the UV-visible spectrum of extract was compared with the UV-visible spectrum of
standard polyenes classes from the literature [15].
2.4. Selection of Natural Variant and Screening in Shake Flask
The 5 ml of sterile tween 80 (0.1%) was added to fully sporulated slant. The spores were scraped with sterile
cell scraper. The spore suspension was filtered through sterile cotton to remove the mycelial residues. The spore
suspension was spread on AS-AIA. The plates were incubated at 30˚C for 30 days. The colonies having different
morphology and sporulation pattern were picked up and transferred on AS-AIA slants. These variants were
screened in shake flask as mentioned in 2.3. The harvested broth was extracted with equal amount of methanol
and then serially diluted up to 1:1024 dilutions. Antifungal activities of this extract were checked by agar well
diffusion assay [14].
2.5. Phylogenetic Identification of PM0525875
DNA was isolated from the active strain (PM0525875) grown in ASW-ISP2 (International Streptomyces Project
Medium 2) containing [dextrose 4 g/L, yeast extract 4 g/L, malt extract 10 g/L, made in 75% ASW, pH 7.0 to
7.5]. DNA from washed cell suspension was extracted using Ultraclean TM Tissue and Cells DNA Isolation kit,
Mo Bio Laboratories, Inc. PCR-mediated amplification of 16S rRNA gene was carried out using 16 S universal
primers: 8 F (AGAGTTTGATCCTGGCTCAG), 1492 R (ACGGCTACCTTGTTACGACTT) and BDTv3.1
Cycle sequencing kit on ABI 3730x1 Genetic Analyzer. The near complete 16S rRNA sequence (1377 bp) was
desired and aligned with corresponding first ten matching sequences. The program CLUSTALW2
(www.ebi.ac.uk/Tools/msa/clustalw2/) was used for both multiple alignment and phylogenetic analyses. Based
on maximum identity score, first ten sequences were selected and aligned using multiple alignment software
program Clustal W. Distance matrix was generated using RDP database and phylogenic tree was constructed
using MEGA5.
2.6. Large Scale Fermentation
The higher yielding variant (PM0525875-V4) was selected for cultivation in 30 L fermenter. The seed was pre-
pared from 96 h grown culture in 200 ml ASW-274(1) medium in 1000 ml Erlenmeyer flask. The fermenter was
sterilized in-situ at 121˚C for 25 min along with the ASW-36P(1) medium containing 0.04% antifoam. A 3% of
mature seed was aseptically inoculated into a fermenter. The fermentation process was carried out at 30˚C, 180
rpm, and 0.6 vvm with a backpressure 0.5 bar and for 96 h. Periodically 200 ml of sample was aseptically with-
drawn for determination of packed cell volume (PCV) and total sugar content [16]. The antifungal activity of
extract was performed as mentioned in 2.4.
2.7. Bioactivity Guided Isolation and Purification
The 8.5 L fermented broth was centrifuged at 4000 rpm for 30 min to separate the biomass. The 400 g of bio-
mass was extracted with methanol and clear solvent layer was obtained by filtration. Three subsequent extrac-
tions were performed. The extracts were pooled and concentrated to make it solvent free. The dried crude extract
was suspended in demineralized water and further passed through a glass column packed with diaion HP-20 re-
sin having bed volume 225 ml. The resin was washed twice with 3 L of demineralized water to remove the un-
bounded components and media particles. The resin column was further eluted with water and methanol gra-
dient with varying polarity. The bioactive fractions were pooled together and evaporated till dryness with a ro-
tary evaporator. The methanolic extract was further fractionated with petroleum ether followed by dichlorome-
thane. The active dichloromethane extract (500 mg) was subjected to silica gel column chromatography and
eluted with gradient of chloroform-methanol. The fractions were tested for bioactivity against Candida sp. (disc
diffusion assay). The active fractions were pooled together and concentrated till dryness to get semi pure sample.
The semi-pure material (100 mg) was further purified by preparative chromatography using the following condi-
tions: C-18 Eurospher column (20 mm ¡Á 250 mm, 10 ¦Ìm) in isocratic mode and eluted with acetonitrile and
0.01 M phosphate buffer (35:65) at a flow rate 20 ml/min with UV detection wave length at 220 nm. The pure
active fraction (eluted at 11 - 13 min) was evaporated under reduced pressure and desalted using HP-20 resin
followed by elution with methanol. The eluted solvent was concentrated to get pure compound (20 mg). The pu-
rified compound was characterized by  1 H NMR, MS and IR spectroscopy. All the solvents used for extraction
were of LR grade, where as HPLC grade solvents were used for analytical and preparative HPLC. Analytical
HPLC purity was determined in Water¡¯s Empower software LC using Kromasil RP-18, SN: 39673 (150 mm ¡Á
4.6 mm), 3.5 ¦Ìm column. Normal column chromatography (CC) was performed on Silica gel (60 - 120 #) and
TLC on Silica Gel 60F 254 (20 ¡Á 20 cm) aluminum sheets from Merck. NMR Spectra were recorded in DMSO-d6
on Bruker 300 MHz. Chemical shifts are expressed in ppm and tetramethylsilane was used as an internal stan-
dard. Mass spectra were taken on Bruker Daltonics system. IR spectra were recorded in pressed KBr discs with
Perkin Elmer PARAGON1000 spectrometer.
2.8. Determination of MIC of Isolated Bioactive Compound
The MIC was determined by the NCCLS (CLSI) Macrobroth dilution method [17] [18]. The cultures used for
the assay were Candida albicans, Candida albicans CO9, Candida glabrata FlucR HO5 and Candida krusei FlucR
GO3. The inoculum was prepared in sterile saline adjusted at an optical density (OD) of 1.00 at 600 nm com-
prising of 10 8 cfu/ml. The final working inoculum was 0.5 ¡Á 10 4 cfu/ml. The bioactive compound was diluted in
the concentration range of 0.019 - 10 ¦Ìg/ml. The concentration range for amphotericin B used was 0.031 - 16
¦Ìg/ml and for fluconazole was 0.5 - 256 ¦Ìg/ml. The assay tubes were incubated at 37˚C for 48 h following
which the visible growth was noted and the MIC value determined.

» ²ÂÄãϲ»¶

ÒÑÔÄ   »Ø¸´´ËÂ¥   ¹Ø×¢TA ¸øTA·¢ÏûÏ¢ ËÍTAºì»¨ TAµÄ»ØÌû
Ïà¹Ø°æ¿éÌø×ª ÎÒÒª¶©ÔÄÂ¥Ö÷ bxzc123 µÄÖ÷Ìâ¸üÐÂ
×î¾ßÈËÆøÈÈÌûÍÆ¼ö [²é¿´È«²¿] ×÷Õß »Ø/¿´ ×îºó·¢±í
[¿¼ÑÐ] µ÷¼Á +25 ²»·ê´º 2026-04-07 26/1300 2026-04-12 11:53 by ´óÁ¦Ë®ÊÖÁ¦´óÎÞÇ
[¿¼ÑÐ] 305Çóµ÷¼Á +7 Â꿨°Í¿¨boom 2026-04-11 7/350 2026-04-12 07:35 by zhouxiaoyu
[¿¼ÑÐ] 291·Öµ÷¼Á +5 Éϰ¶Ð¡Ó¨¼ÓÓÍ 2026-04-09 6/300 2026-04-11 21:06 by ÄæË®³Ë·ç
[¿¼ÑÐ] 22408µ÷¼ÁÇóÖú +7 ì±12 2026-04-09 9/450 2026-04-11 09:23 by ŶŶ123
[¿¼ÑÐ] 085506-Çóµ÷¼Á-285·Ö +3 À×Å··ÉÌß 2026-04-08 3/150 2026-04-11 08:37 by zhq0425
[¿¼ÑÐ] 080500Çóµ÷¼Á +17 »ÆÓ 2026-04-06 17/850 2026-04-11 08:36 by zhq0425
[¿¼ÑÐ] ²ÄÁÏ085601µ÷¼Á +25 ºÎÈó²É123 2026-04-10 27/1350 2026-04-10 23:17 by Ftglcn90
[¿¼ÑÐ] 083200 305·Ö Çó¶þÂÖµ÷¼Á ²»½ÓÊÜ¿çרҵ +9 Claireyyyy 2026-04-09 10/500 2026-04-10 21:21 by Claireyyyy
[¿¼ÑÐ] Çóµ÷¼Á +5 ²»»á·ÉµÄÓã@ 2026-04-10 5/250 2026-04-10 19:07 by chemisry
[¿¼ÑÐ] 0856ר˶Çóµ÷¼Á Ï£ÍûÊÇaÇøÔºÐ£ +21 ºÃºÃÐÝÏ¢ºÃ²»ºÃ 2026-04-09 24/1200 2026-04-10 16:58 by luoyongfeng
[¿¼ÑÐ] ½­ËÕ´óѧ ¹¤¿Æµ÷¼Á ¼ñ© +3 Evan_Liu 2026-04-09 5/250 2026-04-10 10:22 by Evan_Liu
[¿¼ÑÐ] ±¾¿ÆÎ÷¹¤´ó 0856 324Çóµ÷¼Á +10 wysyjs25 2026-04-09 11/550 2026-04-10 08:37 by 5268321
[¿¼²©] ²©Ê¿×Ô¼ö +7 ¿É¿ÉСÅÖ 2026-04-08 7/350 2026-04-10 08:28 by kimhero
[¿¼ÑÐ] 085501»úеӢ¶þ77×Ü·Ö294Çóµ÷¼Á£¬½ÓÊÜ¿çרҵѧϰ +6 ÊØ·¨¹«ÃñØÁ¼Í 2026-04-08 6/300 2026-04-09 15:55 by wp06
[¿¼ÑÐ] ²ÄÁϵ÷¼Á +14 Ò»ÑùYWY 2026-04-05 15/750 2026-04-09 13:36 by ¹ÊÈË??
[¿¼ÑÐ] ÉúÎïѧѧ˶£¬³õÊÔ351·Ö£¬Çóµ÷¼Á +4 ¡­¡«¡¢Íõ¡­¡« 2026-04-08 5/250 2026-04-08 21:49 by limeifeng
[¿¼ÑÐ] 0703»¯Ñ§µ÷¼Á 348·Ö +14 °¦ÎÒ³¬ÕæÃ»ÕÐÁË 2026-04-06 15/750 2026-04-08 19:16 by ÎÒ¼õ·Ê1
[¿¼ÑÐ] 265Çóµ÷¼Á +19 Сľ³æ085600 2026-04-06 21/1050 2026-04-08 10:38 by ÄæË®³Ë·ç
[¿¼ÑÐ] Ò»Ö¾Ô¸±±½»´ó²ÄÁϹ¤³Ì×Ü·Ö358Çóµ÷¼Á +10 cs0106 2026-04-05 12/600 2026-04-06 19:41 by Î޼ʵIJÝÔ­
[¿¼ÑÐ] 377Çóµ÷¼Á +6 by.ovo 2026-04-05 6/300 2026-04-05 22:18 by dongzh2009
ÐÅÏ¢Ìáʾ
ÇëÌî´¦ÀíÒâ¼û